Access premium articles, webinars, resources to make the best decisions for career, course, exams, scholarships, study abroad and much more with
Plan, Prepare & Make the Best Career Choices
NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance: Your search ends here, as we provide detailed questions and answers for the Molecular Basis of Inheritance NCERT that are in accordance with the most recent CBSE Syllabus 2022–23. Do you know what acts as the genetic material of living organisms? The answer is DNA. In order to find solutions to such questions and study for the board exams, students can use these NCERT Solutions for Class 12. You will learn some important facts in Molecular Basis of Inheritance NCERT Solutions talk about DNA, which acts as the genetic material in most organisms. Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are the two types of nucleic acids found in living systems. Continue reading to learn more about NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance.
Molecular Basis of Inheritance NCERT Solutions: Class 12 Students will learn about RNA, which, though it also acts as genetic material in some viruses, mostly functions as a messenger. RNA has additional roles as well. It functions as an adapter; it is structural; and in some cases, it acts as a catalytic molecule. NCERT Solutions for Class 12 Biology Chapter 6 - Molecular Basis of Inheritance provide Questions and answers based on our Chapter 6 Biology Class 12. If you want solutions for any other class (6–12), then NCERT solutions are there for you.
According to the CBSE Syllabus 2023–24, the Molecular Basis of Inheritance NCERT chapter has been renumbered as Chapter 5.
Also Read,
The Class 12 Biology Chapter 6 NCERT Solutions are given in the sequence below as per the NCERt Textbook data:
Q1. Group the following as nitrogenous bases and nucleosides:
Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine.
Answer:
Nitrogenous bases- Adenine, thymine, uracil and cytosine
Nucleosides- Cytidine and guanosine
Q2. If a double stranded DNA has 20 per cent of cytosine, calculate the per cent of adenine in the DNA.
Answer:
By Chargaff's rule, we know that A=T and G=C. Since there are 20% cytosines, so guanines percentage will also be 20%. The G+C count is 20+20= 40%. Therefore, the remaining 60% will be contributed equally by adenine and thymine. Thus, the percentage of adenine and thymine are 30% each.
Molecular Basis of Inheritance Class 12 Solutions:
Q3. If the sequence of one strand of DNA is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of complementary strand in direction.
Answer:
With regard to base pairs the DNA strand are complementary to each other. So, if the sequence of DNA is
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
The sequence of the complementary strand will be
3`- TACGTACGTACGTACGTACGTACGTACG - 5`.
In 5' - 3' strand, it can be written as
5'- GCATGCATGCATGCATGCATGCATGCAT-3'
Q4. If the sequence of the coding strand in a transcription unit is written as follows:
5'-ATGCATGCATGCATGCATGCATGCATGC-3'
Write down the sequence of mRNA.
Answer:
The sequence of mRNA is the same as the coding strand of DNA except that thymine is replaced by uracil. Thus, the sequence of mRNA will be
5' - AUGCAUGCAUGCAUGCAUGCAUGCAUGC - 3'.
Molecular Basis of Inheritance Class 12 NCERT Solutions:
Answer:
The property of DNA double helix which led Watson and Crick to hypothesise semi-conservative mode of DNA replication is that the two strands of DNA are antiparallel and complementary to each other in terms of their base sequences. This arrangement suggests that DNA replication is semiconservative. During replication, the two strands unwind and each strand acts as a template for the synthesis of a new strand. At the end of replication, DNA of parental types and recombinant types are formed.
Answer:
Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesised from it (DNA or RNA), two types of nucleic acid polymerases are found
1. DNA dependent DNA polymerase- It uses a DNA as a template to synthesise new strand of DNA.
2. DNA dependent RNA polymerase- It uses DNA as a template to synthesise RNA.
NCERT Solutions for Class 12 Biology Chapter 6:
Answer:
Alfred Hershey and Martha Chase (1952) worked with a virus that infects bacteria called bacteriophages. They used different radioactive isotopes to label DNA and protein. In their experiment, in one preparation, the protein part was made radioactive and in the other, nucleic acid (DNA) was made radioactive. These two phage preparations were allowed to infect the culture of E.coli . Soon after infection, before the lysis of cells, the E.coli cells were gently agitated in a blender, to loosen the adhering phage particles and the culture was centrifuged. The heavier infected bacterial cells pelleted to the bottom and the lighter viral particles were present in the supernatant. It was found that when bacteriophage containing radioactive DNA was used to infect E.coli, the pellet contained radioactivity. If bacteriophage containing radioactive protein coat was used to infect E.coli, the supernatant contained most of the radioactivity. Their experiment showed that protein does not enter the bacterial cell while DNA gets transformed. Hence, they proved that DNA is the genetic material.
Class 12 Biology Chapter 6 question answer:
Q8. Differentiate between the followings:
(a) Repetitive DNA and Satellite DNA
Answer:
Repetitive DNA | Satellite DNA |
Repetitive DNA refers to DNA sequences containing small segments that are repeated many times | DNA sequences containing highly repetitive DNA. |
Answer:
mRNA or messenger RNA | tRNA or transfer RNA |
It acts as the template for the translation of proteins. | tRNA acts as the adapter molecule that carries specific amino acid to mRNA for the synthesis of a polypeptide. |
(c) Template strand and Coding strand
Answer:
Template strand | Coding strand |
It is the template for the synthesis of mRNA during transcription | Strand of DNA having the same sequence as mRNA (thymine in DNA is replaced by uracil in RNA |
Its polarity is 3' to 5' | Its polarity is 5' to 3' |
Class 12 Molecular Basis of Inheritance NCERT Solutions:
Q9. List two essential roles of ribosome during translation.
Answer:
The ribosome is a complex structure made up of ribonucleoproteins. It consists of two subunits i.e. a larger subunit and a smaller subunit. The essential roles of ribosomes during translation are as follows:
1. Ribosome acts as the site of protein synthesis. The larger subunit of ribosome act as an amino acid binding site while small subunit attaches to the mRNA.
2. Ribosome acts as a catalyst for forming peptide bonds.
Answer:
Lac operon refers to a segment of DNA which consists of one regulatory gene (i ) and three structural genes (y,z and a). Among the three structural genes, the z gene code for enzyme beta-galactosidase, that is responsible for the hydrolysis of the disaccharide lactose into its monomeric units, galactose and glucose. Gene y code for enzyme permease, which increases the permeability of the cell. The gene a encode for enzyme transacetylase. Lactose which is called the inducer is the substrate for enzyme beta-galactosidase and it regulates switching on and off of the operon. The regulatory gene, i code for the repressor of the lac operon. Lactose can bind to the repressor an inactivate it. When lactose is bound to the repressor, the RNA polymerase binds to the promoter of the lac operon. As a result of this, the transcription of three structural genes takes place and they form their respective enzymes. Further, these enzymes metabolize the lactose and lead to the formation of glucose and galactose. When the lactose metabolism is at its highest, the repressor protein is set free to bind with the operator gene. As a result of this, the transcription of lac operon stops. Therefore, lac operon shut down sometime after addition of lactose in the medium.
Q11. Explain (in one or two lines) the function of the followings:
Answer:
Function of promoter
Promoter gene refers to the site where the RNA polymerase enzyme binds and transcription of mRNA starts.
Answer:
Function of tRNA
tRNA plays a major role in the process of protein synthesis. It reads the genetic code present on mRNA.
Q12. Why is the Human Genome project called a mega project?
Answer:
Human Genome project is called a mega project because its specific goal is to sequence every base pair in the human genome. HGP took approximately 13 years to accomplish in 2006. The main aim of HGP was to develop new technology and generate new information in genomic studies. Because of this project, many new areas have opened in genetics. Thus HGP is a mega project.
Q13. What is DNA fingerprinting? Mention its application.
Answer:
DNA fingerprinting is a very easy and quick way to compare the DNA sequence of any two individuals. It includes identifying differences in some specific regions in DNA sequence called as repetitive DNA sequences. In these regions, a small stretch of DNA is repeated many times and they are specific for every individual. The technique of fingerprinting was initially developed by Alec Jeffrey.
Applications of DNA fingerprinting
1. It is used in forensic science in order to identify individuals.
2. It can be used to establish paternity or maternity related disputes.
3. DNA fingerprinting is used to establish evolutionary relationships between organisms.
Q14 . Briefly describe the following:
Answer:
Transcription- It refers to the process of copying genetic information from one strand of DNA into mRNA. In transcription, only one strand is copied into the RNA. While copying, the place of adenine is taken up by uracil. The transcription of DNA includes a transcription unit. The transcription unit is consists of a promoter, the structural gene and a terminator. The strands that have polarity 3’-5' act as a template and called template strand while the other strand is called coding strand. A schematic structure of a transcription unit is given below.
The promoter is located at the 5’ end and it binds the enzyme RNA polymerase to start transcription. Sigma factor also helps in initiation of the process of transcription.The terminator is located at 3’end of coding strand and usually defines the end of transcription where rho factor will bind to terminate transcription.
Answer:
Polymorphism- It refers to a special kind of genetic variation in which nucleotide sequence can exist at a particular site in a DNA molecule. This heritable mutation is caused due to a mutation in either somatic cell or in the germ cell. It ultimately results in the accumulation of various mutations at one site. Polymorphism brings revolution in the process of finding a location on the chromosome for disease-associated sequences and tracing human history.
14 . (c) Translation
Answer:
Translation- The process of polymerisation of amino acids into a polypeptide chain is referred to as translation. The order and sequence of amino acids in a polypeptide chain is dependent upon the base sequence of mRNA. Process of translation involves three steps i.e. initiation, elongation and termination. During the initiation, the ribosome binds to the mRNA at the start codon which is AUG. Ribosomes further move from codon to codon along the mRNA for elongation of the polypeptide chain. In the end, the release factors bind to the stop codon, leading to the termination of translation and release of the polypeptide from the ribosome.
Answer:
Bioinformatics- It is a recent and very effective area in the field of biology. In this discipline, the knowledge from the DNA sequences is used for solving various doubt regarding organisms which can not be studied on them in real-time. Therefore, we can say that we utilize the biological information stored in the DNA of an organism.
Important Topics in NCERT Solutions for Class 12 Biology Molecular Basis of Inheritance:
Section | Topic Name |
6 | Molecular Basis of Inheritance |
6.1 | The DNA |
6.2 | The Search for Genetic Material |
6.3 | RNA World |
6.4 | Replication |
6.5 | Transcription |
6.6 | Genetic Code |
6.7 | Translation |
6.8 | Regulation of Gene Expression |
6.9 | Human Genome Project |
6.10 | DNA Fingerprinting |
6.11 | Summary |
Chapter 6 Biology Class 12 NCERT Solutions are well-structured in accordance with the CBSE syllabus for 2023-24. Solutions for the molecular basis of inheritance NCERT contains most of the answers to DNA and RNA related questions. You will learn that DNA stores genetic information, RNA mostly helps in the transfer and expression of information. Though DNA and RNA both function as genetic material, DNA being chemically and structurally more stable is a better genetic material. However, RNA is the first to evolve and DNA was derived from RNA.
Molecular basis of inheritance NCERT also provide solutions to the questions based on the human genome project as it was a megaproject that aimed to sequence every base in the human genome. This project has yielded much new information among us. Many new areas and avenues have opened up as a consequence of the project. In the molecular basis of inheritance Class 12 solutions, you will get an explanation of DNA Fingerprinting. It is a technique to find out variations in individuals of a population at the DNA level. It works on the principle of polymorphism in DNA sequences.
Class 12 Biology Chapter 6 NCERT solutions have questions and answers based on two important nucleic acid which is also called as genetic materials for living organisms and these are:
In molecular basis of inheritance Class 12 NCERT Solutions, you will get questions on Central dogma which consists of three important things that are:
After going through Biology Chapter 6 Class 12, you will be able to answer all the questions which are given at the end of this chapter.
The key features of Class 12 Biology Chapter 6 NCERT Solutions are listed below:
And if still, you have any doubt or problems in getting the correct answers then the molecular basis of inheritance ncert solutions will help you. But don't forget to try at least once, so that you can answer those questions by yourself then check your answers with the given solutions for NCERT Class 12 biology chapter 6 molecular basis of inheritance.
Chapter 1 | Reproduction in organisms |
Chapter 2 | Sexual Reproduction in Flowering Plants |
Chapter 3 | Human Reproduction |
Chapter 4 | Reproductive Health |
Chapter 5 | Principles of Inheritance and Variation |
Chapter 6 | Molecular basis of inheritance |
Chapter 7 | Evolution |
Chapter 8 | Human Health and Disease |
Chapter 9 | Strategies for Enhancement in Food Production |
Chapter 10 | Microbes in Human Welfare |
Chapter 11 | Biotechnology: Principles and Processes |
Chapter 12 | Biotechnology and its Applications |
Chapter 13 | Organisms and Populations |
Chapter 14 | Ecosystem |
Chapter 15 | Biodiversity and Conservation |
Chapter 16 | Environmental Issues |
NCERT solutions for Class 12 Maths |
NCERT solutions for Class 12 Chemistry |
NCERT solutions for Class 12 Biology |
NCERT solutions for Class 12 Physics |
NCERT Exemplar Class 12 Chemistry Solutions |
NCERT Exemplar Class 12 Mathematics Solutions |
NCERT Exemplar Class 12 Biology Solutions |
NCERT Exemplar Class 12 Physics Solutions |
We hope that you will ace in your board examinations and competitives exams with the help of NCERT Solutions for Class 12 Biology Chapter 6 Molecular Basis of Inheritance.
Important components of central dogma are:
The important topics of solutions for the molecular basis of inheritance ncert are:
The applications of DNA fingerprinting given in molecular basis of inheritance ncert are:
To download solutions for the molecular basis of inheritance ncert, students can use the online webpage to pdf converter tools. To Score Well in the examination, follow the NCERT syllabus and exercise given in the NCERT Book. To practice more problems, students can refer to the NCERT exemplar
Yes, by practising the NCERT Solutions for Class 12 Biology Chapter 6, you can earn all of the points. The following is a list of the reasons why the solutions PDF are significant.
1. The answers help students confidently prepare for the Class 12 board exams.
2. Students can easily understand the concepts thanks to the step-by-step explanations provided for each question.
3. Each concept's diagrams encourage visual learning, which is crucial for exam success.
4. In keeping with the standards of the CBSE Board exams, the solutions produced are concise and clear.
Hello aspirant,
The purpose of graphic design extends beyond the brand's look. Nevertheless, by conveying what the brand stands for, it significantly aids in the development of a sense of understanding between a company and its audience. The future in the field of graphic designing is very promising.
There are various courses available for graphic designing. To know more information about these courses and much more details, you can visit our website by clicking on the link given below.
https://www.careers360.com/courses/graphic-designing-course
Thank you
Hope this information helps you.
hello,
Yes you can appear for the compartment paper again since CBSE gives three chances to a candidate to clear his/her exams so you still have two more attempts. However, you can appear for your improvement paper for all subjects but you cannot appear for the ones in which you have failed.
I hope this was helpful!
Good Luck
Hello dear,
If you was not able to clear 1st compartment and now you giving second compartment so YES, you can go for your improvement exam next year but if a student receives an improvement, they are given the opportunity to retake the boards as a private candidate the following year, but there are some requirements. First, the student must pass all of their subjects; if they received a compartment in any subject, they must then pass the compartment exam before being eligible for the improvement.
As you can registered yourself as private candidate for giving your improvement exam of 12 standard CBSE(Central Board of Secondary Education).For that you have to wait for a whole year which is bit difficult for you.
Positive side of waiting for whole year is you have a whole year to preparing yourself for your examination. You have no distraction or something which may causes your failure in the exams. In whole year you have to stay focused on your 12 standard examination for doing well in it. By this you get a highest marks as a comparison of others.
Believe in Yourself! You can make anything happen
All the very best.
Hello Student,
I appreciate your Interest in education. See the improvement is not restricted to one subject or multiple subjects  and  we cannot say if improvement in one subject in one year leads to improvement in more subjects in coming year.
You just need to have a revision of all subjects what you have completed in the school. have a revision and practice of subjects and concepts helps you better.
All the best.
Hi,
You just need to give the exams for the concerned two subjects in which you have got RT. There is no need to give exam for all of your subjects, you can just fill the form for the two subjects only.
Database professionals use software to store and organise data such as financial information, and customer shipping records. Individuals who opt for a career as data administrators ensure that data is available for users and secured from unauthorised sales. DB administrators may work in various types of industries. It may involve computer systems design, service firms, insurance companies, banks and hospitals.
The field of biomedical engineering opens up a universe of expert chances. An Individual in the biomedical engineering career path work in the field of engineering as well as medicine, in order to find out solutions to common problems of the two fields. The biomedical engineering job opportunities are to collaborate with doctors and researchers to develop medical systems, equipment, or devices that can solve clinical problems. Here we will be discussing jobs after biomedical engineering, how to get a job in biomedical engineering, biomedical engineering scope, and salary.
A career as ethical hacker involves various challenges and provides lucrative opportunities in the digital era where every giant business and startup owns its cyberspace on the world wide web. Individuals in the ethical hacker career path try to find the vulnerabilities in the cyber system to get its authority. If he or she succeeds in it then he or she gets its illegal authority. Individuals in the ethical hacker career path then steal information or delete the file that could affect the business, functioning, or services of the organization.
GIS officer work on various GIS software to conduct a study and gather spatial and non-spatial information. GIS experts update the GIS data and maintain it. The databases include aerial or satellite imagery, latitudinal and longitudinal coordinates, and manually digitized images of maps. In a career as GIS expert, one is responsible for creating online and mobile maps.
The invention of the database has given fresh breath to the people involved in the data analytics career path. Analysis refers to splitting up a whole into its individual components for individual analysis. Data analysis is a method through which raw data are processed and transformed into information that would be beneficial for user strategic thinking.
Data are collected and examined to respond to questions, evaluate hypotheses or contradict theories. It is a tool for analyzing, transforming, modeling, and arranging data with useful knowledge, to assist in decision-making and methods, encompassing various strategies, and is used in different fields of business, research, and social science.
Individuals who opt for a career as geothermal engineers are the professionals involved in the processing of geothermal energy. The responsibilities of geothermal engineers may vary depending on the workplace location. Those who work in fields design facilities to process and distribute geothermal energy. They oversee the functioning of machinery used in the field.
If you are intrigued by the programming world and are interested in developing communications networks then a career as database architect may be a good option for you. Data architect roles and responsibilities include building design models for data communication networks. Wide Area Networks (WANs), local area networks (LANs), and intranets are included in the database networks. It is expected that database architects will have in-depth knowledge of a company's business to develop a network to fulfil the requirements of the organisation. Stay tuned as we look at the larger picture and give you more information on what is db architecture, why you should pursue database architecture, what to expect from such a degree and what your job opportunities will be after graduation. Here, we will be discussing how to become a data architect. Students can visit NIT Trichy, IIT Kharagpur, JMI New Delhi.
Individuals who opt for a career as a remote sensing technician possess unique personalities. Remote sensing analysts seem to be rational human beings, they are strong, independent, persistent, sincere, realistic and resourceful. Some of them are analytical as well, which means they are intelligent, introspective and inquisitive.
Remote sensing scientists use remote sensing technology to support scientists in fields such as community planning, flight planning or the management of natural resources. Analysing data collected from aircraft, satellites or ground-based platforms using statistical analysis software, image analysis software or Geographic Information Systems (GIS) is a significant part of their work. Do you want to learn how to become remote sensing technician? There's no need to be concerned; we've devised a simple remote sensing technician career path for you. Scroll through the pages and read.
Budget analysis, in a nutshell, entails thoroughly analyzing the details of a financial budget. The budget analysis aims to better understand and manage revenue. Budget analysts assist in the achievement of financial targets, the preservation of profitability, and the pursuit of long-term growth for a business. Budget analysts generally have a bachelor's degree in accounting, finance, economics, or a closely related field. Knowledge of Financial Management is of prime importance in this career.
The invention of the database has given fresh breath to the people involved in the data analytics career path. Analysis refers to splitting up a whole into its individual components for individual analysis. Data analysis is a method through which raw data are processed and transformed into information that would be beneficial for user strategic thinking.
Data are collected and examined to respond to questions, evaluate hypotheses or contradict theories. It is a tool for analyzing, transforming, modeling, and arranging data with useful knowledge, to assist in decision-making and methods, encompassing various strategies, and is used in different fields of business, research, and social science.
An underwriter is a person who assesses and evaluates the risk of insurance in his or her field like mortgage, loan, health policy, investment, and so on and so forth. The underwriter career path does involve risks as analysing the risks means finding out if there is a way for the insurance underwriter jobs to recover the money from its clients. If the risk turns out to be too much for the company then in the future it is an underwriter who will be held accountable for it. Therefore, one must carry out his or her job with a lot of attention and diligence.
A Product Manager is a professional responsible for product planning and marketing. He or she manages the product throughout the Product Life Cycle, gathering and prioritising the product. A product manager job description includes defining the product vision and working closely with team members of other departments to deliver winning products.
Individuals in the operations manager jobs are responsible for ensuring the efficiency of each department to acquire its optimal goal. They plan the use of resources and distribution of materials. The operations manager's job description includes managing budgets, negotiating contracts, and performing administrative tasks.
Individuals who opt for a career as a stock analyst examine the company's investments makes decisions and keep track of financial securities. The nature of such investments will differ from one business to the next. Individuals in the stock analyst career use data mining to forecast a company's profits and revenues, advise clients on whether to buy or sell, participate in seminars, and discussing financial matters with executives and evaluate annual reports.
A Researcher is a professional who is responsible for collecting data and information by reviewing the literature and conducting experiments and surveys. He or she uses various methodological processes to provide accurate data and information that is utilised by academicians and other industry professionals. Here, we will discuss what is a researcher, the researcher's salary, types of researchers.
Welding Engineer Job Description: A Welding Engineer work involves managing welding projects and supervising welding teams. He or she is responsible for reviewing welding procedures, processes and documentation. A career as Welding Engineer involves conducting failure analyses and causes on welding issues.
A career as Transportation Planner requires technical application of science and technology in engineering, particularly the concepts, equipment and technologies involved in the production of products and services. In fields like land use, infrastructure review, ecological standards and street design, he or she considers issues of health, environment and performance. A Transportation Planner assigns resources for implementing and designing programmes. He or she is responsible for assessing needs, preparing plans and forecasts and compliance with regulations.
Individuals who opt for a career as an environmental engineer are construction professionals who utilise the skills and knowledge of biology, soil science, chemistry and the concept of engineering to design and develop projects that serve as solutions to various environmental problems.
A Safety Manager is a professional responsible for employee’s safety at work. He or she plans, implements and oversees the company’s employee safety. A Safety Manager ensures compliance and adherence to Occupational Health and Safety (OHS) guidelines.
A Conservation Architect is a professional responsible for conserving and restoring buildings or monuments having a historic value. He or she applies techniques to document and stabilise the object’s state without any further damage. A Conservation Architect restores the monuments and heritage buildings to bring them back to their original state.
A Structural Engineer designs buildings, bridges, and other related structures. He or she analyzes the structures and makes sure the structures are strong enough to be used by the people. A career as a Structural Engineer requires working in the construction process. It comes under the civil engineering discipline. A Structure Engineer creates structural models with the help of computer-aided design software.
Highway Engineer Job Description: A Highway Engineer is a civil engineer who specialises in planning and building thousands of miles of roads that support connectivity and allow transportation across the country. He or she ensures that traffic management schemes are effectively planned concerning economic sustainability and successful implementation.
Are you searching for a Field Surveyor Job Description? A Field Surveyor is a professional responsible for conducting field surveys for various places or geographical conditions. He or she collects the required data and information as per the instructions given by senior officials.
Orthotists and Prosthetists are professionals who provide aid to patients with disabilities. They fix them to artificial limbs (prosthetics) and help them to regain stability. There are times when people lose their limbs in an accident. In some other occasions, they are born without a limb or orthopaedic impairment. Orthotists and prosthetists play a crucial role in their lives with fixing them to assistive devices and provide mobility.
A career in pathology in India is filled with several responsibilities as it is a medical branch and affects human lives. The demand for pathologists has been increasing over the past few years as people are getting more aware of different diseases. Not only that, but an increase in population and lifestyle changes have also contributed to the increase in a pathologist’s demand. The pathology careers provide an extremely huge number of opportunities and if you want to be a part of the medical field you can consider being a pathologist. If you want to know more about a career in pathology in India then continue reading this article.
Gynaecology can be defined as the study of the female body. The job outlook for gynaecology is excellent since there is evergreen demand for one because of their responsibility of dealing with not only women’s health but also fertility and pregnancy issues. Although most women prefer to have a women obstetrician gynaecologist as their doctor, men also explore a career as a gynaecologist and there are ample amounts of male doctors in the field who are gynaecologists and aid women during delivery and childbirth.
The audiologist career involves audiology professionals who are responsible to treat hearing loss and proactively preventing the relevant damage. Individuals who opt for a career as an audiologist use various testing strategies with the aim to determine if someone has a normal sensitivity to sounds or not. After the identification of hearing loss, a hearing doctor is required to determine which sections of the hearing are affected, to what extent they are affected, and where the wound causing the hearing loss is found. As soon as the hearing loss is identified, the patients are provided with recommendations for interventions and rehabilitation such as hearing aids, cochlear implants, and appropriate medical referrals. While audiology is a branch of science that studies and researches hearing, balance, and related disorders.
An oncologist is a specialised doctor responsible for providing medical care to patients diagnosed with cancer. He or she uses several therapies to control the cancer and its effect on the human body such as chemotherapy, immunotherapy, radiation therapy and biopsy. An oncologist designs a treatment plan based on a pathology report after diagnosing the type of cancer and where it is spreading inside the body.
Are you searching for an ‘Anatomist job description’? An Anatomist is a research professional who applies the laws of biological science to determine the ability of bodies of various living organisms including animals and humans to regenerate the damaged or destroyed organs. If you want to know what does an anatomist do, then read the entire article, where we will answer all your questions.
For an individual who opts for a career as an actor, the primary responsibility is to completely speak to the character he or she is playing and to persuade the crowd that the character is genuine by connecting with them and bringing them into the story. This applies to significant roles and littler parts, as all roles join to make an effective creation. Here in this article, we will discuss how to become an actor in India, actor exams, actor salary in India, and actor jobs.
Individuals who opt for a career as acrobats create and direct original routines for themselves, in addition to developing interpretations of existing routines. The work of circus acrobats can be seen in a variety of performance settings, including circus, reality shows, sports events like the Olympics, movies and commercials. Individuals who opt for a career as acrobats must be prepared to face rejections and intermittent periods of work. The creativity of acrobats may extend to other aspects of the performance. For example, acrobats in the circus may work with gym trainers, celebrities or collaborate with other professionals to enhance such performance elements as costume and or maybe at the teaching end of the career.
Career as a video game designer is filled with excitement as well as responsibilities. A video game designer is someone who is involved in the process of creating a game from day one. He or she is responsible for fulfilling duties like designing the character of the game, the several levels involved, plot, art and similar other elements. Individuals who opt for a career as a video game designer may also write the codes for the game using different programming languages.
Depending on the video game designer job description and experience they may also have to lead a team and do the early testing of the game in order to suggest changes and find loopholes.
Radio Jockey is an exciting, promising career and a great challenge for music lovers. If you are really interested in a career as radio jockey, then it is very important for an RJ to have an automatic, fun, and friendly personality. If you want to get a job done in this field, a strong command of the language and a good voice are always good things. Apart from this, in order to be a good radio jockey, you will also listen to good radio jockeys so that you can understand their style and later make your own by practicing.
A career as radio jockey has a lot to offer to deserving candidates. If you want to know more about a career as radio jockey, and how to become a radio jockey then continue reading the article.
The word “choreography" actually comes from Greek words that mean “dance writing." Individuals who opt for a career as a choreographer create and direct original dances, in addition to developing interpretations of existing dances. A Choreographer dances and utilises his or her creativity in other aspects of dance performance. For example, he or she may work with the music director to select music or collaborate with other famous choreographers to enhance such performance elements as lighting, costume and set design.
A career as social media manager involves implementing the company’s or brand’s marketing plan across all social media channels. Social media managers help in building or improving a brand’s or a company’s website traffic, build brand awareness, create and implement marketing and brand strategy. Social media managers are key to important social communication as well.
Photography is considered both a science and an art, an artistic means of expression in which the camera replaces the pen. In a career as a photographer, an individual is hired to capture the moments of public and private events, such as press conferences or weddings, or may also work inside a studio, where people go to get their picture clicked. Photography is divided into many streams each generating numerous career opportunities in photography. With the boom in advertising, media, and the fashion industry, photography has emerged as a lucrative and thrilling career option for many Indian youths.
An individual who is pursuing a career as a producer is responsible for managing the business aspects of production. They are involved in each aspect of production from its inception to deception. Famous movie producers review the script, recommend changes and visualise the story.
They are responsible for overseeing the finance involved in the project and distributing the film for broadcasting on various platforms. A career as a producer is quite fulfilling as well as exhaustive in terms of playing different roles in order for a production to be successful. Famous movie producers are responsible for hiring creative and technical personnel on contract basis.
In a career as a copywriter, one has to consult with the client and understand the brief well. A career as a copywriter has a lot to offer to deserving candidates. Several new mediums of advertising are opening therefore making it a lucrative career choice. Students can pursue various copywriter courses such as Journalism, Advertising, Marketing Management. Here, we have discussed how to become a freelance copywriter, copywriter career path, how to become a copywriter in India, and copywriting career outlook.
In a career as a vlogger, one generally works for himself or herself. However, once an individual has gained viewership there are several brands and companies that approach them for paid collaboration. It is one of those fields where an individual can earn well while following his or her passion.
Ever since internet costs got reduced the viewership for these types of content has increased on a large scale. Therefore, a career as a vlogger has a lot to offer. If you want to know more about the Vlogger eligibility, roles and responsibilities then continue reading the article.
For publishing books, newspapers, magazines and digital material, editorial and commercial strategies are set by publishers. Individuals in publishing career paths make choices about the markets their businesses will reach and the type of content that their audience will be served. Individuals in book publisher careers collaborate with editorial staff, designers, authors, and freelance contributors who develop and manage the creation of content.
Careers in journalism are filled with excitement as well as responsibilities. One cannot afford to miss out on the details. As it is the small details that provide insights into a story. Depending on those insights a journalist goes about writing a news article. A journalism career can be stressful at times but if you are someone who is passionate about it then it is the right choice for you. If you want to know more about the media field and journalist career then continue reading this article.
Individuals in the editor career path is an unsung hero of the news industry who polishes the language of the news stories provided by stringers, reporters, copywriters and content writers and also news agencies. Individuals who opt for a career as an editor make it more persuasive, concise and clear for readers. In this article, we will discuss the details of the editor's career path such as how to become an editor in India, editor salary in India and editor skills and qualities.
Individuals who opt for a career as a reporter may often be at work on national holidays and festivities. He or she pitches various story ideas and covers news stories in risky situations. Students can pursue a BMC (Bachelor of Mass Communication), B.M.M. (Bachelor of Mass Media), or MAJMC (MA in Journalism and Mass Communication) to become a reporter. While we sit at home reporters travel to locations to collect information that carries a news value.
Are you searching for a Corporate Executive job description? A Corporate Executive role comes with administrative duties. He or she provides support to the leadership of the organisation. A Corporate Executive fulfils the business purpose and ensures its financial stability. In this article, we are going to discuss how to become corporate executive.
A multimedia specialist is a media professional who creates, audio, videos, graphic image files, computer animations for multimedia applications. He or she is responsible for planning, producing, and maintaining websites and applications.
Welding Engineer Job Description: A Welding Engineer work involves managing welding projects and supervising welding teams. He or she is responsible for reviewing welding procedures, processes and documentation. A career as Welding Engineer involves conducting failure analyses and causes on welding issues.
A quality controller plays a crucial role in an organisation. He or she is responsible for performing quality checks on manufactured products. He or she identifies the defects in a product and rejects the product.
A quality controller records detailed information about products with defects and sends it to the supervisor or plant manager to take necessary actions to improve the production process.
A Product Manager is a professional responsible for product planning and marketing. He or she manages the product throughout the Product Life Cycle, gathering and prioritising the product. A product manager job description includes defining the product vision and working closely with team members of other departments to deliver winning products.
A QA Lead is in charge of the QA Team. The role of QA Lead comes with the responsibility of assessing services and products in order to determine that he or she meets the quality standards. He or she develops, implements and manages test plans.
A Structural Engineer designs buildings, bridges, and other related structures. He or she analyzes the structures and makes sure the structures are strong enough to be used by the people. A career as a Structural Engineer requires working in the construction process. It comes under the civil engineering discipline. A Structure Engineer creates structural models with the help of computer-aided design software.
The Process Development Engineers design, implement, manufacture, mine, and other production systems using technical knowledge and expertise in the industry. They use computer modeling software to test technologies and machinery. An individual who is opting career as Process Development Engineer is responsible for developing cost-effective and efficient processes. They also monitor the production process and ensure it functions smoothly and efficiently.
An AWS Solution Architect is someone who specializes in developing and implementing cloud computing systems. He or she has a good understanding of the various aspects of cloud computing and can confidently deploy and manage their systems. He or she troubleshoots the issues and evaluates the risk from the third party.
An Azure Administrator is a professional responsible for implementing, monitoring, and maintaining Azure Solutions. He or she manages cloud infrastructure service instances and various cloud servers as well as sets up public and private cloud systems.
Careers in computer programming primarily refer to the systematic act of writing code and moreover include wider computer science areas. The word 'programmer' or 'coder' has entered into practice with the growing number of newly self-taught tech enthusiasts. Computer programming careers involve the use of designs created by software developers and engineers and transforming them into commands that can be implemented by computers. These commands result in regular usage of social media sites, word-processing applications and browsers.
A Product Manager is a professional responsible for product planning and marketing. He or she manages the product throughout the Product Life Cycle, gathering and prioritising the product. A product manager job description includes defining the product vision and working closely with team members of other departments to deliver winning products.
Individuals in the information security manager career path involves in overseeing and controlling all aspects of computer security. The IT security manager job description includes planning and carrying out security measures to protect the business data and information from corruption, theft, unauthorised access, and deliberate attack
An Automation Test Engineer job involves executing automated test scripts. He or she identifies the project’s problems and troubleshoots them. The role involves documenting the defect using management tools. He or she works with the application team in order to resolve any issues arising during the testing process.